Teaching resource developed while working as a high school Science and IT teacher in NSW Australia
1,913 Downloads | Download PDF DOC
Name: ________________ What will studying this unit teach me about the world? After thinking about the ideas and activities in this unit you should be able to: 1. decode a secret message using a simple cipher 2. give one example of a secret code or cipher which has been used in the past and explain why it was used. 3. describe two methods of encoding information from nature and two from technology. 4. write the chemical formula of a compound given enough information. 5. write a word equation for a chemical reaction given enough information. 6. explain that all the information needed to make a human and to keep it functioning is encoded in chromosomes. 7. explain where chromosomes are found and that they are the same within each normal cell of a particular organism. 8. explain that the DNA molecules within a living cell are a molecular code which stores all the information needed for the organism to grow and function. 9. label a simple diagram showing the structure of DNA. 10. describe a gene as a section of DNA which encodes the information about a particular characteristic of the organism. 11. explain that the sequence of bases in a molecule of DNA form a code which corresponds to particular amino acids in proteins. 12. describe what cell division is and why it occurs. 13. describe what biotechnology is and give one example. 14. give an example of a difficult ethical question about biotechnology and suggest various answers to the problem. Secret codes and ciphers Codes and ciphers can be used to send secret messages. Only those with special knowledge can decode or decipher them to understand what they mean. Codes and ciphers are slightly different from each other. A code is a method of writing a secret message in which each word is replaced by a secret code word or symbol. A cipher is a method of secret writing in which every letter, instead of every word, has a secret symbol. About 150 years ago the telegraph was introduced into Australia. This enabled people to send messages quickly over long distances for the first time. This changed people's lives and the way society worked. In order to send messages by telegraph, language had to be translated into another code - called Morse code. In Morse code each letter of the alphabet was represented by a set of dots and dashes because these could easily be sent along an electric wire. You can make a circuit which is able to send Morse code. A simple circuit which can do this can be made by connecting an electric cell, a tapping switch and a light bulb together in series, as shown in the circuit diagram below (you need to be able to understand the way information is encoded in a circuit diagram to interpret this drawing): The Long And The Short Of It 2 is a symbol for a light bulb is the symbol for a switch is the symbol for an electric power source such as a battery After you have set up the circuit you can encode a message to send to another member of the class. Make up a short message in English and use the Morse Code table on this worksheet to translate the message into Morse Code. Send the message by tapping (long and short taps) on the switch in your circuit. The person who is receiving the message watches the light bulb and writes down the pattern of long and short flashes which are sent. The Morse Code message can then be translated back into normal language using the Morse Code table. Real circuits for sending Morse Code on the telegraph were of course much bigger than this one. Wires in the telegraph circuits were hundreds of kilometres long so that messages could be sent from one town to another. Messages were received not as light flashes but as sounds. Morse Code Alphabet Navajo Code Talkers Navajo code talkers took part in every assault the U.S. Marines conducted in the Pacific from 1942 to 1945. They served in all six Marine divisions, Marine Raider battalions and Marine parachute units, transmitting messages by telephone and radio in their native language -- a code that the Japanese never broke. The idea to use Navajo for secure communications came from Philip Johnston, the son of a missionary to the Navajos and one of the few non-Navajos who spoke their language fluently. Johnston, reared on the Navajo reservation, was a World War I veteran who knew of the military's search for a code that would withstand all attempts to decipher it. He also knew that Native American languages--notably Choctaw--had been used in World War I to encode messages. Johnston believed Navajo answered the military requirement for an undecipherable code because Navajo is an unwritten language of extreme complexity. Its syntax and tonal qualities, not to mention dialects, make it unintelligible to anyone without extensive exposure and training. It has no alphabet or symbols, and is spoken only on the Navajo 3 lands of the American Southwest. One estimate indicates that less than 30 non-Navajos, none of them Japanese, could understand the language at the outbreak of World War II. Early in 1942, Johnston met with Major General Clayton B. Vogel, the commanding general of Amphibious Corps, Pacific Fleet, and his staff to convince them of the Navajo language's value as code. Johnston staged tests under simulated combat conditions, demonstrating that Navajos could encode, transmit, and decode a three-line English message in 20 seconds. Machines of the time required 30 minutes to perform the same job. Convinced, Vogel recommended to the Commandant of the Marine Corps that the Marines recruit 200 Navajos. In May 1942, the first 29 Navajo recruits attended boot camp. Then, at Camp Pendleton, Oceanside, California, this first group created the Navajo code. They developed a dictionary and numerous words for military terms. The dictionary and all code words had to be memorized during training. Once a Navajo code talker completed his training, he was sent to a Marine unit deployed in the Pacific theatre. The code talkers' primary job was to talk, transmitting information on tactics and troop movements, orders and other vital battlefield communications over telephones and radios. They also acted as messengers, and performed general Marine duties. Praise for their skill, speed and accuracy accrued throughout the war. At Iwo Jima, Major Howard Connor, 5th Marine Division signal officer, declared, "Were it not for the Navajos, the Marines would never have taken Iwo Jima." Connor had six Navajo code talkers working around the clock during the first two days of the battle. Those six sent and received over 800 messages, all without error. The Japanese, who were skilled code breakers, remained baffled by the Navajo language. The Japanese chief of intelligence, Lieutenant General Seizo Arisue, said that while they were able to decipher the codes used by the U.S. Army and Army Air Corps, they never cracked the code used by the Marines. The Navajo code talkers even stymied a Navajo soldier taken prisoner at Bataan. (About 20 Navajos served in the U.S. Army in the Philippines.) The Navajo soldier, forced to listen to the jumbled words of talker transmissions, said to a code talker after the war, "I never figured out what you guys who got me into all that trouble were saying." In 1942, there were about 50,000 Navajo tribe members. As of 1945, about 540 Navajos served as Marines. From 375 to 420 of those trained as code talkers; the rest served in other capacities. Navajo remained potentially valuable as code even after the war. For that reason, the code talkers, whose skill and courage saved both American lives and military engagements, only recently earned recognition from the Government and the public. The Navajo Code Talker's Dictionary When a Navajo code talker received a message, what he heard was a string of seemingly unrelated Navajo words. The code talker first had to translate each Navajo word into its English equivalent. Then he used only the first letter of the English equivalent in spelling an English word. Thus, the Navajo words "wol-la-chee" (ant), "be-la-sana" (apple) and "tse-nill" (axe) all stood for the letter "a." One way to say the word "Navy" in Navajo code would be "tsah (needle) wol-la-chee (ant) ah-keh-di- glini (victor) tsah-ah-dzoh (yucca)." Most letters had more than one Navajo word representing them. Not all words had to be spelled out letter by letter. The developers of the original code assigned Navajo words to represent about 450 frequently used military terms that did not exist in the Navajo language. Several examples: "besh- lo" (iron fish) meant "submarine," "dah-he- tih-hi" (hummingbird) meant "fighter plane" and "debeh-li-zine" (black street) meant "squad." 4 Department of Defence Honours Navajo Veterans Long unrecognised because of the continued value of their language as a security classified code, the Navajo code talkers of World War II were honoured for their contributions to defence on Sept. 17, 1992, at the Pentagon, Washington, D.C. This method of enciphering was developed in Europe in the 16th century. Can you tell what this means? Can you hide a message in a pig pen? You can work out what it means if you know how the message was enciphered in the first place. It was done by drawing up a frame, a bit like one for a naughts and crosses game, and writing in it the letters of the alphabet as follows: A J S B K T C L U D M V E N W F O X G P Y H Q Z I R Using this diagram, the letters are given symbols in the following way: A N = = B Z = = C X = = Look at these examples and work out the pattern. Now decipher the message at the top of the page. Now try this one: hide words in pictures Pictures are powerful ways of encoding information. Many road signs don't use words, but are able to communicate information such as "the road is slippery" using pictures alone. 5 Pictures can also be used to encipher messages. Use the key and the map below to find out where the hidden treasure lies. A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 6 Hide messages by exploding words apart! Using a transposition cipher, the letters in words are split and then moved around (their positions are changed). There are lots of different ways to construct a transposition cipher. Here is one way. The message is written out in ordinary words. Then it is written out again in two lines. The first letter goes on the top line, the second letter on the bottom line, the third letter on the top line again and so on. Message: Top line: Bottom line: THI T H I SCLASSROOMI C S L A S S R O O M I SBUGGED S B U G G E D Then to obtain the completely enciphered message, the letters of the top line are written out, followed by the letters on the bottom line, like this: TICASOMSUGD HSLSROIBGE There are lots of different ways to make up transposition ciphers (you could, for example split the letters up into three lines or write the final lines out backwards). You could make up a method yourself and use it to encipher a message. Work out what this message means - it has been enciphered using the transposition cipher described on this worksheet. WYITEUBEUCOSHRA?EASIWSTCTTEHCESOT HDDHBBLGMRSTEODBCUETASUKOHCIKNFO 7 Hide a message by regrouping letters This is a very easy way of enciphering a message - unfortunately that means the hidden message is easy to work out as well! The letters of the words in the message are written together, all capital letters and with no spaces between the words. So the message, “Your teacher is a double agent!” becomes: YOURTEACHERISADOUBLEAGENT! The letters are then regrouped into, for example, groups of three, to make the enciphered message: YOU RTE ACH ERI SAD OUB LEA GEN T! Work out what this message means: EVA CUA TEI MME DIA TEL Y! Work out the following messages: 1. WHA TDO YOU CALL ACA TON THE BEA CHA TCH RIS TMA STI ME? SAN DYC LAW S 2. WH YD OB IR DS FL YS OU TH FO RT HE WI NT ER? BE CA US EI TS TO OF AR TO WA LK. ?backwards write you can ways many How A message can be enciphered using a backwards alphabet. The alphabet is written once in the normal order. Beneath it is written the alphabet in the reverse order. ABCDEFGH I J K L MN OP QR S T U V WX Y Z I HGFEDCBA Z Y X WV U T S R QP ON ML K J This table can now be used to find out which letters to write when using the backward cipher. A becomes Z, B becomes Y, C becomes X and so on. Decipher the following messages: 1. GSVIV ZIV UREV YRIWH RM Z GIVV ZMW Z SFMGVI HSLLGH GDL LU GSVN. SLD NZMB ZIV OVUG RM GSV GIVV? MLMV, GSV IVHG UOVD ZDZB. 2. DSZG'H GSV WRUUVIVMXV YVGDVVM Z UOZHSRMT IVW GIZUURX ORTSG ZMW Z UOZHSRMT BVOOLD GIZUURX ORTSG? GSV XLOLFI. 8 use a sentence as a key to unlock a message What does this say? 31-13-34-82-32-13! 84-92-22 82-32-13 31-13-23-35-93 34-82-11-24-12-13-91! There is a message which makes sense encoded in these numbers, but you need a key to unlock this information. A sentence which contains all the letters of the alphabet at least once can be used as a key to encipher and then decipher a message. For example, the sentence: THE 1 QUICK 2 BROWN 3 FOX 4 JUMPS 5 OVER 6 THE 7 LAZY 8 DOG. 9 contains all the letters of the alphabet. Each word in the sentence can be given a number (as shown above). Any letter of the alphabet can then be given a set of two numbers which identify its position in the sentence. So, for example, the letter "M" is given the numbers 5 and 3 or 53. This is because it occurs in word number 5 ("JUMPS") and is the third letter in this word. Similarly, the letter "O" can be replaced by the number 33 (it is the third letter in the third word), and the letter "D" can be replaced by the number 91. Some letters occur more than once in the sentence, and so more than one number can represent them. Can you work out what the message at the top of this worksheet says? Try deciphering the following message: 34-12-82-11 93-33-13-55 31-33-33 12-33-33 55-54-81-82-11? 55-33-53-73-33-35-13 24-32-84-23-35-93 11-12-13-23-32 13-84-13-55 33-22-11. You could try making up your own keyword sentence (remember that it has to contain all the letters in the alphabet at least once) and using it to encipher some messages. Give the keyword sentence only to those people you want to be able to understand the message. Rebus - can you tell what it means? A rebus is a representation of a word or phrase using pictures or symbols which are not the normal letters used to spell the words. So the heading at the top of this worksheet doesn't make sense as a normal word, but it does if you say the names of the letters out loud. Rebuses are another way of encoding information - in this case language. Rebuses are usually made up as puzzles, however, making rebuses was also an important step in the history of the development of written language. About six thousand years ago, in the Middle East, the ancient Sumerians developed a system of writing down language using pictures. They drew a picture to represent the object they were talking about. This system has limitations - there are some ideas we have words for which we can't really draw a picture of - for example, feelings like happiness or sadness. To overcome this problem, the Sumerians started to use pictures to represent sounds, rather than objects. So a picture of a bee could mean a bee or it could mean the sound "B". Using rebuses in this way made it possible to write words to represent any idea. 9 Our written language encodes our spoken language in a similar way. However, the symbols we use, our letters, don't look like pictures. Here are some rebus sentences - see if you can work out what they mean. ancay ouyay peaksay ikelay away igpay? Pig Latin is a type of secret language. It sounds strange when it is spoken and written down, but it is not hard to learn. To translate a word into Pig Latin, you must first of all decide whether the word begins with a consonant or a vowel (a, e , i, o or u). If the word begins with a consonant, take the first letter from the beginning of the word, put it at the end of the word and add "ay". So "pig" becomes "igpay" and "latin" becomes "atinlay". The only complication with this comes if the word starts with a group of letters which make one sound - like "ch", "br", "pl" or "scr". If this is the case, just move the whole group of letters to the end of the word and add "ay". So, "children" becomes "ildrenchay" and "cry" becomes "ycray". If the word begins with a vowel, you simply add the letters "way" to the end of the word - you don't have to take any letters from the beginning of the word. So, "at" becomes "atway" and "elephant" becomes "elephantway". To translate a word from Pig Latin into English, simply reverse the process - take the "ay" or "way" off the end and put the last letter in the word first if necessary. 10 See if you can translate the following messages from Pig Latin to English: 1. ewarebay ofway hetay usbay riverday earingway unsay lassesgay leasepay allcay hetay hiefcay onway ouryay hoesay elephonetay 2. Make up a message to send to the person next to you and translate it into Pig Latin before you send it. 3. Try making up your own secret language in a way similar to Pig Latin. Write down the rules for translating a message into your language. Send a message in your language to the person next to you. hide a message using a wheel A letter spokes cipher clock can be used to hide a message by changing the identity of letters in a random way. The cipher clock is made up by drawing a circle and writing the letters of the alphabet around the outside of the circle, as shown below. Each letter in the alphabet is then joined to one other letter by a straight line (also shown in the diagram above). So if, for example, the letter "A" is joined to the letter "P" in the cipher clock, "P" is written instead of "A" and "A" is written instead of "P" when the message is enciphered. The concealed message can be worked out or deciphered using the reverse process. Use the cipher clock on this page to work out what this important message means: BCQLCXL ZX HTL OPXHLLX ZB HFKZXW HC ACZBCX KCD! 11 Binary Languages Information can be encoded using a large number of different symbols (like the English language which uses twenty six different letters) or it can be encoded using just two symbols. A system of encoding which uses only two different symbols can be called a binary language ("bi" means "two"). Computers are used to process information. The information must be encoded in some way for the computer to understand it. A binary language is used to encode the information in a computer. Computers use a binary language because it is easy to have two different symbols in a system made up of electrical circuits. A circuit can either be "on" (this is one symbol) or "off" (this is the other symbol). Lots of different messages can be encoded by using more than one circuit in combination. How do bar codes show how much a product in a shop costs? Almost everything we buy in shops has a bar code printed on it. Bar codes are another way of encoding information. In this case, the information represented by the pattern of lines in the bar code is a set of numbers. Each product sold in a shop has its own, unique set of numbers, which are represented by a particular pattern of thick and thin lines in the bar code. The number codes for the products are listed in a computer data base. This can store information about the price of the product, whether or not it is on sale, how many of the product has been sold and how many are left in stock. When we are shopping, the scanner scans the bar code, it is then interpreted as a number and a computer uses the data base to find out the price which corresponds to that number. This price is then shown on the cash register. All this happens very quickly - much faster than a shop assistant could type in the price from a price tag. Look at the bar codes you have collected over the past weeks. You should have between five and ten examples, including some for different products produced by the same company. Use your bar codes to answer the following questions. Some of these require some careful observation. Write the answers to the questions in your book under the heading "Bar codes". 1. Look at all the bar codes you have collected. What features do all the bar codes have in common? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 2. Each number is represented by two lines (not counting the pairs of slightly longer thin lines found at the beginning, middle and end of the bar code). How many numbers are represented by the bar code? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 12 3. Half the bar code represents the company which made the product and the other half is the code for the product itself. Which half is which? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 4. Write down the set of six numbers which encodes one of the companies represented in your bar code collection. Which company is it? ________________________________________________________________________ ________________________________________________________________________ 5. Write down the set of six numbers which encodes one of the products represented in your bar code collection. Which product is it? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 6. Using the company part of the bar code only, write down the bar code pair of lines which represent the numbers 2 and 3. (Look at single numbers to so this - so find a single 2 by itself, not a pair or triplet of 2's). ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 7. Can you think of a practical reason why the numbers corresponding to the bar code are printed below the code? If so, what is it? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 8. How do bar codes make shopping easier for the shopper? (How did the system work before scanners and bar codes?) Can you think of some way in which the bar code system is a disadvantage for the shopper? If so, what? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 9. How do bar codes make running a shop easier? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 13 10. Think about what happens when you go to pay for your purchases in a supermarket. Draw a diagram with arrows to represent the way the information encoded in the bar code leads to the price of the product appearing on the cash register screen. (You may need to read the introductory notes at the beginning of this worksheet again). ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 11. Make up the name of a product and company. Make up codes for them using six numbers. Translate these number codes into bar codes to make a bar code for your product. Design and draw a label for the product which includes the bar code. ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 12. Find out how bar codes are used in libraries. Are the codes of the same general form as the bar codes used for products in shops or not? What information is kept on the data base which is linked to the bar codes? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 13. Can you think of any other situations where bar codes could be useful? If so, what? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 14. Write a short science fiction story about a future world in which bar codes to represent individual people are introduced and tattooed on some part of our bodies. What would be the advantages and disadvantages of a system like this? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 14 Bar Code Collecting Sheet For homework collect at least five bar codes from different products. In each case, stick down the bar code; write the name of the product and the name of the company which produced it in the appropriate place in the table. At least the same company should produce two of the products. Bar code What is the product? Which company made it? 15 Chemical codes Chemistry is the study of substances. Special ways of encoding information have been developed to use in the study of substances in chemistry. These chemical codes make it easier to communicate information about substances. However, we need to learn how to interpret these chemical codes. A chemical formula is a type of chemical code to represent a substance. For example, water can be represented by the formula H2O. This code can be interpreted as meaning that one molecule of water consists of 2 atoms of hydrogen bonded with 1 atom of oxygen. A chemical equation is a chemical code to represent a reaction. For example, the chemical equation: water hydrogen gas + oxygen gas can be interpreted as meaning that in a chemical reaction, water can change into hydrogen gas and oxygen gas. In each of the following questions, a chemical reaction has been described using a sentence. Read the sentence and then write a chemical word equation to represent the reaction described. The first question has been done for you, as an example. 1. When baking soda (its chemical name is sodium hydrogen carbonate) is heated it changes into washing soda (chemical name sodium carbonate). Carbon dioxide and water are also given off as the baking soda is heated. Write a chemical word equation to represent this chemical reaction using the chemical names for the substances. Answer: sodium hydrogen carbonate sodium carbonate + carbon dioxide + water 2. When natural gas burns in a heater, it joins with oxygen to make carbon dioxide and water. The reaction also lets off a lot of heat energy. Write a word equation to represent this reaction which many people use to keep warm in winter. 3. When hydrochloric acid is poured onto a piece of limestone, the rock starts to fizz, showing that a gas is being given off in a chemical reaction. The reaction happens because the rock contains calcium carbonate which reacts with hydrochloric acid to make carbon dioxide gas, water and calcium chloride. Write a chemical word equation to represent the reaction between the hydrochloric acid and the calcium carbonate. 16 4. Hydrogen peroxide solution can be used to kill germs. If hydrogen peroxide solution is heated up it starts to bubble. It is breaking down (a type of reaction) to make oxygen gas and water. Write a word equation to represent this reaction. 5. About 8000 years ago humans learned how to get the metal lead out of compounds of lead, such as lead oxide, which are quite different from the metal. If lead oxide is heated strongly with carbon, it reacts to produce the metal lead and carbon monoxide. Write a word equation for this reaction which has been used for thousands of years. 6. When wine is made, yeast is used to change the sugar glucose into ethanol (alcohol). Bubbles of carbon dioxide gas are also formed during the reaction. Write an equation for this reaction which has been used by humans to produce alcoholic drinks for thousands of years. 7. Plaster of Paris can be made by heating the mineral gypsum. Water comes out of the gypsum during the reaction. Write a chemical word equation to represent this chemical change. A chemical equation shows the reactants and products in a chemical reaction, and the proportions in which they react. The formulae for the reactants and products can be written in a symbol equation. Numbers may also appear in front of the formulae in symbol equations. These show the proportions in which the reactants combine to form the products. For example, consider the following word and symbol equations for a neutralisation reaction zinc oxide + hydrochloric acid -> zinc chloride + water ZnO + 2HCl -» ZnCl2 + H2O Symbol equations The following table shows a list of these common types of reactions. Be very careful when you use this list. There are many, many exceptions, for very good chemical reasons. It is always best to observe the reaction itself, just to be certain that the reaction does proceed, as you would expect. Reactant(s) acid + metal acid + base (Neutralisation reaction) acid + carbonate acid + metal oxide combustion with oxygen Likely product(s) salt + hydrogen salt + water salt + carbon dioxide + water salt + water common oxide (s) 17 Chemical formulas The left hand column of this table contains diagrams of molecules of some substances. The name of the substance is written underneath. Write a chemical formula in the right hand column to represent the substance. hydrogen (H) atom carbon (C) atom oxygen (O) atom nitrogen (N) atom chlorine (Cl) atom Diagram of a molecule of the substance Formula to represent the substance The chemical formula which represents methane is: CH4 methane The chemical formula which represents water is: water The chemical formula which represents ammonia is: ammonia The chemical formula which represents carbon dioxide is: carbon dioxide The chemical formula which represents hydrogen chloride is: hydrogen chloride The chemical formula which represents hydrogen cyanide is: hydrogen cyanide 18 Try these harder ones; hydrogen (H) atom carbon (C) atom oxygen (O) atom anthracine glucose 19 A card game for 3 to 5 players. The cards for this game are in two sets: • • cards which show a diagram which represents a particular molecule cards which show the chemical formula which represents a particular molecule There are an equal number of cards in the two sets and the cards belong in pairs - one card coming from each set. So, for example, the card with the picture which shows a molecule made of one hydrogen atom joined to one chlorine atom belongs in a pair with the card which shows the chemical formula HCl. The game is played in the same way as the traditional card game "Gin Rummy". The cards are shuffled and all the cards are dealt out. The aim of the game is to get rid of all these cards by forming legitimate pairs. Once two cards form a pair they are placed face up on the table. The players start by forming any pairs they can from their original cards. Then the players take it in turns (round the circle in a clockwise direction) to chose a card from the player on their right without being able to see which card it is. Once they have looked at their new card they form any more pairs they can. In this way the cards are circulated around the group. This process continues until one of the players has got rid of all their cards and wins the game. Players should be careful to check one another's pairing of the cards to make sure they are correct. The game is best played with four or five players. 20 How do our bodies encode information? Our bodies seem to know how to work on their own even though there are millions of processes going on in a body all the time. There must be a message or a source of information somewhere in our body which tells it how to work. This information can be found in tiny structures called chromosomes which can be found in the nuclei of cells. All the normal cells in the body have the same set of chromosomes. Chromosomes are able to give the body the information it needs to function and grow. This information is stored in a molecular code. cell membrane This part of the cell controls what enters and leaves the cell. nucleus This part of the cell controls the processes which go on in the cell. cytoplasm This fills the cell. Most of the processes which happen in the cell take place here. It contains many other tiny structures. 21 Activity: What do chromosomes look like? Look at the pictures of cells you have been given. Using a sharp lead pencil, draw one of the cells paying special attention to the chromosomes which can be seen. Draw with clear lines, rather than sketching or shading. Give your drawing a title which explains what it is. Next to the title write down how many times the picture of the cell has been magnified, to give an idea of how small the cell and its chromosomes really are. Write a sentence underneath your drawing which describes what the chromosomes in the cell look like. 22 Can you work out how to get some DNA out of some peas? Read the information in these boxes. They are connected in some ways. All living material is made up of cells. Each cell in living material is surrounded by a cell membrane. This membrane is made up of fat molecules and protein molecules. The DNA in chromosomes is combined with and protected by protein molecules. The cells in living material can be separated by breaking up the living material into pieces. DNA is found inside cells so the cell membranes must be broken in order to get the DNA out. Enzymes can cut protein molecules up, if the right enzymes are chosen for the job. Putting living material into a blender chops up the material and breaks it into pieces. Soap or detergent breaks up cell membranes because it combines with fat molecules. Meat tenderizer contains enzymes which are able to cut up protein molecules. Free DNA can be separated from a mixture of other substances in water by adding alcohol. The DNA moves out of the water into the alcohol. Use the information in the boxes to answer the following questions. 1. How could you separate the cells in a piece of living material (such as a piece of meat, or vegetable or fruit)? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 2. What could you do to the living material, after the cells have been separated, which would break open the cell membranes? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 23 3. After the cell membranes have been broken open, what could you do to the living material so that the DNA molecules became separated from the protein molecules which protect them? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 4. Write down what you could do to separate some DNA molecules from some peas. You can write this in point form if you want to. ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ Experiment: What does DNA look like? What you will need This is an experiment to separate some DNA from part of a living thing. • • • dried peas which have been soaked in water overnight (or some other living material such as chopped onion, yeast, spinach, raw chicken liver) 100mL measuring cylinder, 500mL beaker, 250mL beaker, teaspoon for measuring and stirring, strainer salt, liquid soap or detergent, meat tenderiser, isopropyl alcohol (rubbing alcohol) What to do There are quite a few steps in this experiment so you will have to work carefully. Step 1 1. Measure out about 200mL of water, 100mL of soaked peas (or whatever living material you are using) and ¼ teaspoon of salt. Mix these together in a beaker until the salt is dissolved. 2. Put the mixture in a blender and blend for just a couple of seconds so that the peas are chopped up a bit. The mixture should still be lumpy. 3. Pour the mixture back into a clean beaker, add a teaspoon of liquid soap or detergent and stir gently for about five minutes. Step 2 1. Strain about 80mL of the mixture into a smaller beaker. 2. Add about 1/8 of a teaspoon of meat tenderisers to the strained mixture and stir gently for about five minutes. Step 3 1. Gently pour about 80mL of the alcohol on top of the strained mixture in the small beaker. The alcohol will form a separate layer on top of the mixture. 2. The DNA will precipitate in a layer where the alcohol touches the strained mixture. The strands of DNA look white and soft (it looks a bit like snot!). Stir the mixture very gently and the DNA should rise to the top of the alcohol layer. 24 what was the DNA like after it had been separated from the rest of the living material. ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ What is Deoxyribonucleic acid Construct a model of a segment of DNA! All the information needed to keep the processes of life going in a living creature is encoded in a type of molecule called deoxyribonucleic acid or DNA for short. In this activity, you will make a model to represent a short segment of a DNA molecule to help you understand information. Follow the instructions carefully. how it is able to encode DNA is a long, thin molecule composed of two long halves which are only loosely held together and can be pulled apart - a bit like the two halves of a zip being unzipped. Each long half of the molecule has a backbone structure of alternating phosphate and sugar groups which are held together by strong chemical bonds. Find the parts of the model (on your model parts sheet) which represent the long sugar-phosphate backbones (the two long dark sections). Cut these two shapes out. In the DNA molecule, bonded to the sugar-phosphate backbone are a series of molecular groups called bases. They stick out from the sugar-phosphate backbone like the rungs of a ladder. There are essentially four different bases found in DNA. These are called adenine, thymine, guanine and cytosine. The bases on two sugar-phosphate backbones link up in pairs to attach the two backbones to each other. Find the smaller shapes which represent these base groups on your model parts sheet. Cut them out and arrange them in four piles - one for adenine, one for thymine and so on. Choose six of these bases to attach to one of the sugar-phosphate backbones. It does not matter which bases you choose to stick on the first sugar-phosphate backbone (although it is probably best to choose a variety of bases so you don't run out of one sort latter). You can also decide what order put glue here the bases go in. This is what distinguishes one type of DNA molecule from another - the bases which are present and the order in which they are arranged. 25 Stick your chosen six bases to one of the sugar-phosphate backbones. You can do this by bending over the small dotted rectangle on the end of the base which is going to be stuck to the sugar-phosphate backbone. Put glue on the reverse side of the dotted rectangle and glue this to a corresponding dotted rectangle on a sugar shape in the sugar-phosphate backbone. The bases should stick out perpendicularly from the sugarphosphate backbone. You should now have one sugar-phosphate backbone with six bases stuck on to it (sticking out perpendicularly like the rungs of half a ladder). Now six bases need to be attached to the other sugar-phosphate backbone which forms the other half of the molecule. You cannot choose which bases are stuck onto this second backbone. The bases on the second backbone are determined by the bases on the first backbone. When the two backbones with their bases are joined together to form the whole ladder (by joining pairs of bases), only certain pairs of bases will successfully join. Adenine must join up with a thymine (and vice versa). Guanine must join up with a cytosine (and vice versa). No other combinations are possible. So, in terms of our model, the shaded bases must pair with each other and the unshaded bases must pair with each other. Work out which bases you must have on your second sugar-phosphate backbone in order to pair up correctly with those on the first backbone and stick them on. Now the two halves of the DNA segment in your model can be stuck together. Do this by putting glue on the small dotted rectangles at the ends of the bases which are sticking out from one of the sugar-phosphate backbones. Stick the bases together in pairs by overlapping the small dotted rectangles. Make sure the bases are in the correct thymineadenine and cytosine-guanine pairs. In the real molecule these bases are stuck together by an attraction called hydrogen bonding. This hydrogen bonding is weaker than the bonds which hold the sugar-phosphate backbones together. This means it is possible for the DNA molecule to "unzip" down the base pairs. This happens when the information in the DNA molecule is decoded to produce the other molecules required by the living organism. You now have a model representing a short segment of a DNA molecule (a real, complete DNA molecule can include millions of base pairs). However, in order to make the model more realistic, it should be twisted to form a spiral (also called a helix). This twisting can be done more easily with your model if you glue it at the top and the bottom to some base plates. This just makes the model easier to twist. There are of course, no base plates in the real molecule! (Ask your teacher if they would like you to join more than one model segment together before the twisting takes place.) Cut out the two base plates from the model parts sheet. Bend over the ends of the two sugar-phosphate backbones along the dotted lines. Put glue on the bent over bits and use these to glue the backbones to the base plates - one plate at the top and one at the bottom. Let the glue set for a few minutes before you twist the model. To twist the model, hold the bottom base plate with one hand and twist the top base plate with the other hand in an anti-clockwise direction. The real DNA molecule makes one complete twist (through a complete circle) every ten base pairs, so the segment of DNA shown in your model should twist about half a turn. 1. The structure of the real DNA molecule has been described as a "double helix". Why do you think this term was used? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 26 The DNA MOLECULE a base pair one of the sugar-phosphate backbones can you speak dna's language? The DNA inside the nucleus of a cell determines what happens in the cell. So it ultimately controls all the processes which are happening in the body. It does this by controlling which proteins are made in each cell. The proteins form many of the building blocks which make up the cell and are the molecular supervisors which control the processes occurring in the cell. Proteins are long molecules made up of a chain of smaller groups of atoms called amino acids. There are twenty amino acids and proteins differ from each other by having different amino acids joined in different orders. The DNA in a cell has an encoded message which gives the type and order of amino acids which should be chemically joined together to form a particular protein. All of the information required to make all of the proteins needed by the body are encoded in the DNA. These messages are encoded in the language of DNA - the genetic code. As you have probably already learned, the inside of the DNA molecule consists of a long ladder of a series of groups called bases. There are four different bases - adenine, thymine, guanine and cytosine. When the DNA molecule is in action, it unzips along the centre of the rungs of the ladder to expose a length of bases. The bases present, and their order, determine which amino acids are joined together to form a particular protein. 27 How does the order of bases do this - since there are only four different bases and twenty possible amino acids? The answer is that the genetic code uses a set of three bases for every amino acid. So, for example, the bases adenine - thymine - adenine, in that order, are the code for the amino acid tyrosine. Each possible triplet of bases is the code for one of the amino acids or a "stop" code. (Here's a question for people who are good at Maths - how many different sets of three bases can you make from four possible bases? The order of the bases is significant.) In a way this is similar to the English language. There are only twenty six possible letters, but these are able to make millions of different words by being combined in different ways. So, in the DNA language, there are only four different "letters" or bases (adenine, thymine, guanine and cytosine), but these "letters" are able to combine to form 64 different three letter "words". Each "word" stands for a particular amino acid (or the command to stop). A string of words joined to together in the English language can make a sentence. In the same way, a string of base triplets which specify amino acids for a particular protein is said to form a gene. Amazingly, this genetic code appears to be the same for all living creatures on Earth. It is shown in the table. Code AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT Amino acid phenylalanine valine leucine isoleucine cysteine glycine arginine serine serine alanine proline threonine tyrosine asparagine histidine asparagine Code CAA CAC CAG CAT CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT Amino acid leucine valine leucine methionine tryptophan glycine arginine arginine serine alanine proline threonine stop glutamic acid glutamine lysine Code GAA GAC GAG GAT GCA GCC GCG GCT GGA GGC GGG GGT GTA GTC GTG GTT Amino acid phenylalanine valine leucine isoleucine cysteine glycine arginine serine serine alanine proline threonine tyrosine asparagine histidine asparagine Code TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT TTA TTC TTG TTT Amino acid leucine valine leucine isoleucine stop glycine arginine arginine serine alanine proline threonine stop glutamic acid glutamine lysine A = adenine, C = cytosine, G = guanine, T = thymine Table: the genetic code - the sets of three DNA bases which code for each of the twenty amino acids. Now try these examples to see if you can "read" the genetic code: 1. Insulin is a protein produced by some cells in the human body (it is also produced by many other animals as well). It helps to control the amount of glucose in our blood. One molecule of insulin consists of about fifty amino acids joined together in a branched chain. Here is a section of DNA code which could lead to the production of part of the insulin molecule: AAACACGTCTTGGTGTAAACA Work out the amino acid chain which forms this part of the insulin molecule by decoding the segment of genetic code. ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 28 2. Silk is made up of protein molecules. Long stretches of these molecules appear to be made up of a repeating set of six amino acids. One DNA code which could produce this set of six amino acids is: GCCTGAGCCAGCGCCAGC Work out the six amino acids which form this repeating unit in the silk molecules. ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 3. Adrenocorticotropic hormone is one of the most important hormones produced by the pituitary gland. Here is a DNA base sequence which could produce the first ten amino acids in the chain which forms this hormone: ACTGTAACTCATCTCGTGAAAACGCCAACC Would the amino acid sequence in the molecule be changed if the DNA code was changed by: ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ a. changing the first T into a G? If it does change, how does it change? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ b. changing the last A into a T? If it does change, how does it change? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ DNA molecules can be centimetres long. The nucleus of a cell may be only a few micrometres across. So the DNA molecules can be 100,000 times longer than the nucleus. How does the DNA fit in? Activity: How does such a long molecule as DNA fit into a small nucleus? In this activity you will see something happen to a piece of wool which is a bit like the way the DNA molecules are made to fit into the nucleus of the cell. What you need a length of wool about 1 metre long, a metal washer 29 What to do 1. Thread the washer onto the wool and tie the ends of the wool together so that it forms a loop. 2. Hold one end of the loop in each hand, with the washer in the middle. Swing the wool so that the washer moves around and around in a circle, winding the loop of wool up as tightly as you can. 3. Stop swinging the wool and put it down on the desk. Watch what happens. "What we found out" Describe what happened to the wool after the washer was spun. ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ Why was the wool much shorter than it was before? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ Write a sentence to describe how you think the long DNA molecules may be able to fit into the much shorter cell nucleus. ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ How does a cell get its chromosomes? When a living cell divides to form two cells, it makes a copy of its chromosomes so that each daughter cell has its own copy. The process in which one cell divides to make two identical daughter cells is called mitosis. So, because the chromosomes are duplicated, one set for each daughter cell, during mitosis, the genetic information contained in the chromosomes is passed on. 30 Mitosis Mitosis is the process that most cells use to divide. It is the process whereby a single cell divides to form two identical daughter cells. These daughter cells carry the same diploid number of chromosomes and exactly the same genetic information as the parent cell. The DNA within the nucleus has already duplicated itself when the cell starts to divide. The chromosomes shorten and thicken, becoming visible under a microscope. Each chromosome can now be seen to consist of two strands attached at only one point, the centromere. Each chromosome has made a copy of itself and now consists of two identical strands or chromatids. The process is precise. The 'double-stranded' chromosomes line up down the middle of the cell and split into their two chromatids. The chromatids move to opposite ends of the cell and when one of each chromatid reaches its destination, the cell divides into two identical cells, each with the same number of chromosomes as its parent. 1 Why is it essential for the chromosomes to replicate before cell division occurs? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 31 2 Why is it important for the 'double-stranded' chromosomes to line up in single file down the centre of the cell prior to its splitting in two during mitosis? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 3 If a cell started off with 28 chromosomes prior to going through mitosis how many chromosomes would it end with? before cell division occurs? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 4 Why is it important for the cells that are produced to be identical to the parent cell in mitosis but not in meiosis? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ What is biotechnology? Task Go to your school library and find at least four definitions of the word "biotechnology". Write each one of them down - include a statement of where you found the definition. ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 32 Answer the following questions: 1. Which do you think is the best of the definitions you found? Why? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 2. Make up your own definition of "biotechnology". You may make use of the definitions you have found. ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 3. Write down three examples of biotechnology which have been used by humans. ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ 33 Model Parts Sheet sugar phosphate backbones hydrogen (H) atom carbon (C) atom hydrogen (H) atom oxygen (O) atom nitrogen (N) atom hydrogen (H) atom carbon (C) atom hydrogen (H) atom hydrogen (H) atom oxygen (O) atom chlorine (Cl) atom oxygen (O) atom carbon (C) atom arsenic (As) atom sulfur (S) atom chlorine (Cl) atom phosphorus (P) atom hydrogen (H) atom hydrogen (H) atom carbon (C) atom carbon (C) atom oxygen (O) atom bromine (Br) atom sulfur (S) atom hydrogen (H) atom oxygen (O) atom nitrogen (N) atom sulfur (S) atom chlorine (Cl) atom fluorine (F) atom phosphorus (P) atom fluorine (F) atom hydrogen (H) atom nitrogen (N) atom hydrogen (H) atom phosphorus (P) atom fluorine (F) atom bromine (Br) atom hydrogen (H) atom sulfur (S) atom oxygen (O) atom sulfur (S) atom oxygen (O) atom chlorine (Cl) atom Molecul ar Pairs hydrogen (H) atom carbon (C) atom hydrogen (H) atom sulfur (S) atom A card game for 3 to 5 players. CH4 methane H2O water NH3 ammonia CO2 carbon dioxide HCl hydrogen chloride H2O water CS2 carbon disulfide AsCl3 arsenic trichloride PH3 phosphorus trihydride or phosphine CBr4 carbon tetrabromide H2S hydrogen sulfide ("rotten egg" gas) CO2 carbon dioxide O2 oxygen molecule H2 hydrogen molecule N2 nitrogen molecule Cl2 chlorine molecule SF6 sulfur hexafluoride PF5 phosphorus pentafluoride HF hydrogen fluoride NH3 ammonia PBr3 phosphorus tribromide SO2 sulfur dioxide SO2 sulfur dioxide HCl hydrogen chloride H2S hydrogen sulfide ("rotten egg" gas) C2H4 ethene or ethylene (the main starting material used in the production of plastics) Molecul ar Pairs A card game for 3 to 5 players.
You should follow me on Twitter here